How to Submit PAUP Jobs in the Standard Universe (Checkpointing)
Prepare a PAUP batch file
For this example you'll need two files -- one containing a NEXUS dataset and the other containing the PAUP commands. The data set looks like this:
#NEXUS
Begin data;
Dimensions ntax=8 nchar=200;
Format datatype=dna interleave;
Matrix
A CGAATATAACGGAGCCAGTACTCAGACGCACTGCCAACCCAGCGAAGCCCGATACGCCGT
B CGAATATAACGAAGCCAGTATTCAGACGCACTGCTAACCCAGCGGAGCCCGGTACGCCGT
C CGAATATAACAAAGCCAGTACTCGGACGCACTACCAACCCAGCGGAGCCCGATACGCCAT
D CGAATACAACAAAGCCAGTATTCAGACGCACTGCCAACCCAACAGAGACCGGCGTGCTAT
E CGAATACAACAAAGCCAGTATTCAGACGCACTGCCAACCCAGCAGAGACCCCCACGCTAT
F CGAATACAACAAAGCCAGTATTCAGACGCACTGCCAACCCAGCAGAGACCCACACGCTAT
G CGAATACAACAAAGCCAATATTCAGACGGACTGCCAACCCAGCAGAGACCGACACGTCAT
H CGAATACAACAAAGCCAATATTCAGACGGACTGCCAACCCGGCAGAGACCGACGCGTCAT
...
;
end;
Download a copy of the sample data file
here.
The commands used to run a specific analysis are kept in a separate NEXUS file, which will reference the data set given above.
#NEXUS;
Begin paup;
log file=paup.log replace;
execute example_data.nex;
[build a tree using the neighborjoining algorithm]
nj;
savetrees file=paup.tre replace;
quit;
end;
Copy the paup block given above and paste it into a new file named
example_paup.nex.
Test the batch file
Before launching your job under condor, test the batch file at the console to make sure that it is working properly. At this point you should have two file:
example_data.nex and
example_paup.nex.
Type:
condor_paupdev example_paup.nex
Because this is a short analysis, the program should execute and terminate within a second or two, saving a single tree and log file to the current directory. In reality, you will be testing analyses that might run several hours or days before completing. If this is the case, you will want to terminate the analsysis after making sure that PAUP properly executes the file. To interrupt a PAUP process, simply press control+C.
Create a submit file
Now that you know you paup job will run without errors, you need to create a condor submit file. More specific information is on how to create a submit discription file is given in the
UsingCondor topic.
########################################
#
# PAUP run in the Condor standard universe
#
#########################################
Universe = standard
Executable = /usr/common/i686-linux/bin/condor_paupdev
# Use command "which condor_paupdev" to find out the path of "condor_paupdev"
Arguments = example_paup.nex -n -f
# -n Run in "non-interactive" mode (no prompts)
# -f Ignore file-locking
output = example_paup_condor.out
error = example_paup_condor.error
log = example_paup_condor.log
Queue
Copy the text given above and paste it into a new file named
example_paup.cmd.
Logon to an SCS submit node
SCS maintains several submit nodes that give users a way to access SCS computer resources. The general access submit node is named
phoenix. There are also two other submit nodes (
anfinsen and
petal), which are part of restricted access research clusters. Special permission from the resource owner is required to access the
petal and
anfinsen submit nodes.
$ ssh <username>@phoenix.scs.fsu.edu
Submit the job
To submit a job to the condor cluster you will use the
condor_submit command. For example:
$ condor_submit example_paup.cmd
You should see the following output:
Submitting job(s).
Logging submit event(s).
1 job(s) submitted to cluster 56776.
Check the status of a job
After submitting your job to the condor cluster you can check on the status of your job by using the
condor_q command. For example:
$ condor_q <your user name>
The output from this command should look something like this:
-- Submitter: petal017.csit.fsu.edu : <144.174.160.147:10076> : petal017.csit.fsu.edu
ID OWNER SUBMITTED RUN_TIME ST PRI SIZE CMD
56776.0 yanfeng 5/22 18:22 0+00:00:00 R 0 1.8 condor_paupdev exa
1 jobs; 0 idle, 1 running, 0 held
Don't be surprised if your job remains idle (designated by an
I under
ST) for serveral minutes or longer. If your job does not run right away it most likely means that you have a low priority on the cluster and the cluster is being heavily utilized or it may mean that someone job with a lower priority is taking a while to vacate a node so that your job can run. Remember, condor is based on a High Throughput Computing (HTC) model and not a High Performance Comuting (HPC) model.
You can also see what has happened to your job by looking at the condor log file. Remember the condor log file was defined in the condor submit file. To look at the file you might use the
cat command. For example:
$ cat example_paup_condor.log
The output from this command should look something like this:
000 (617.000.000) 10/19 14:34:02 Job submitted from host: <144.174.160.169:11297>
...
001 (617.000.000) 10/19 14:34:32 Job executing on host: <144.174.160.207:9705>
...
005 (617.000.000) 10/19 14:34:32 Job terminated.
(1) Normal termination (return value 1)
Usr 0 00:00:00, Sys 0 00:00:00 - Run Remote Usage
Usr 0 00:00:00, Sys 0 00:00:00 - Run Local Usage
Usr 0 00:00:00, Sys 0 00:00:00 - Total Remote Usage
Usr 0 00:00:00, Sys 0 00:00:00 - Total Local Usage
3346 - Run Bytes Sent By Job
2000108 - Run Bytes Received By Job
3346 - Total Bytes Sent By Job
2000108 - Total Bytes Received By Job
...
Moving on
After the analysis is complete, you should receive and email with more information regarding the execution of our job. In addition, the file that PAUP created during the analysis will be located in your directory. You will also find the the
.out and
.error files in your directory. These files contain the
standard out and
standard error generated by the executable.
This is a barebones example submit file. See the
UsingCondor topic for more information on creating submit files.